SRA

We performed amplicon sequencing to analyze CRISPR off-target editing associated with the gRNA ACGGGATGCCGGGACTTAAG, in the mouse genome. Mouse N2a cells were either uninfected, infected with a modified HSV-1 virus carrying a gene drive cassette targeting the sequence ACGGGATGCCGGGACTTAAG, or infected with a control virus carrying an unspecific gRNA. Cells were collected 3 days after infection. Off-target editing was analyzed at 14 putative sites identified using the online tool CRISPOR v5.2 (http://crispor.gi.ucsc.edu/crispor.py). DNA was extracted using Qiagen DNeasy kit. PCR amplicons, ranging from 180 to 300bp for the 14 sites, were amplified using Phusion Plus high-fidelity polymerase (ThermoFisher, USA) on a Biorad Thermocycler. Amplicons were barcoded and sequenced on an Illumina Nextseq 2000 using 2x150 read format.